Exercise 1A: LEMP-1 You have become interested in a gene that is upregulated in colorectal carcinomas. The annotation you have been given for the gene identifies it as LEMP-1. Does this gene have splice variants? What is its official HGNC symbol for the gene? Does the gene have splice variation that changes the protein product? Which exons are constitutive? Which are alternatively spliced? What does a yellow splice variant indicate? If you based your splice variant analysis only on RefSeq sequences, how many variants would be identified? Retrieve the sequence for the RefSeq variant. ----------------------------------------------------------------------- Exercise 1B: CDH1 Your group is starting an investigation of the E-cadherin gene CDH1 a gene involved in cell adhesion and associated with metastatic cancer transition. Do the splice variants of CDH1 alter the inclusion of Pfam domains? If so, what is the function of these domains and what effect might splice variation have on protein function? Members of your group are very familiar with the protein sequence of this gene but not with the splicing changes of the protein. They want to know the amino acid sequence of exon 10 in the AB025106 variant. Can you get t quickly/easily? Another member of the group needs the nucleotide sequence of exons 9 and 11 to create PCR primers to identify the presence of exon 10. Can you quickly get the nucleic sequence of these exons? What is the RefSeq exon number for the SpliceCenter exon 11? -------------------------------------------------------------------- Exercise 2: BIRC5 Affy U95A, Affy U133A, Agilent Whole Human Genome You are studying the BIRC5 gene. It produces a regulator protein that prevents apoptosis. Expression of BIRC5 is high during fetal development and also in tumors. You are going to do a data mining study of microarray data from previous studies to examine expression of BIRC5. It is time consuming to acquire and process the data. Datasets are available from Affymetrix U95A, Affymetrix U133, and Agilent Whole Genome microarrays. Which of these is most likely to detect expression of all known variants of BIRC5? You would like to correlate expression of this gene from two studies that focused on different types of tumors. One study used the Affymetrix U95A platform and the other used the Agilent Whole Genome array. Which probes / probesets should you use for the correlation? Why? -------------------------------------------------------------------- Exercise 3: IL24 Agilent Human 1A cgacagcctctcaaatgcag ctgagagctgttaccttgtc Using the Agilent Human 1A expression microarray, you discover that expression of the gene IL24 is 10 fold higher in health cells than in diseased cells. To confirm these results you use RT-PCR to quantify the mRNA levels of this gene in the two cell lines. The RT-PCR results show the opposite: normal expression is less than diseased. Can you find any explanation for the discrepancy? Can you suggest alternate primer positions or microarray platforms to resolve the issue? --------------------------------------------------------------------- Exercise 4: HNRNPA1 AACTCGAGGACTGTATTTGTG GGCGGCCCTGGTTACTCTGGA CCGTCATGTCTAAGTCAGAGT You are conducting a experiment in which you would like to silence expression of the HNRNPA1 gene using an siRNA. You are not sure which splice forms are dominant in the cell line you are studying. The three available siRNAs are listed above. Which siRNA has the best chance of silencing expression? If you wanted to selectively silence the NM_031157 variant which siRNA would you use? ------------------------------------------------------------------- Exercise 5: batch siRNA v2HS_113794 CTCATTCTTCAATAGCAAA v2HS_113796 CTTAAGATACTCCAACATT v2HS_227319 CACCAGATGAATTATGGAA v2HS_131688 CTGAAACTGAAATAAGCTA v2HS_131689 CCCATGACGTGTTTCTTGA A project team is planning on using the large-scale shRNA library available as part of the Cancer Genome Anatomy Project (CGAP) to sequentially knock down gene expression in a study cell line. They would like to select shRNAs from the library that target all known splice variants. Can you suggest a method for quickly screening the entire library of 50,000+ shRNAs? Test it on the above sequences.